CRISPR-Cas9 (Active) Protéine

N° du produit ABIN3071564

Détail du produit

Antigène: CRISPR-Cas9

Type de proteíne: Recombinant

Activité biologique: Active

Origine: Streptococcus pyogenes

Source: Escherichia coli (E. coli)

Application: In vitro Cleavage Assay (IVCA), Antibody Production (AbP), Genome Editing with Engineered Nucleases (GEEN)

Specificité: Activity test
Cas9 site-specific digestion:
We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
(CATCATTGGAAAACGTTCTT)
can be digested with gRNA:
(CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hours at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis.

Attributs du produit: GenCrispr Cas9 Nuclease is produced by expression in an E. colistrain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes without nuclear localization signal (NLS).

Purification: purified

Pureté: > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection.

Ingrédients: GenCrispr Cas9 Nuclease
10X Reaction Buffer

Information d'application

Indications d'application: Screening for highly efficient and specific targeting gRNAs by in vitro DNA cleavage using Cas9 Nuclease from S. pyogenes
Highly purified Cas9 antigen could be used for specific antibody production.

Restrictions: For Research Use only

Stockage

Concentration: 0.2 mg/mL

Buffer: 10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
1X Storage Buffer: 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50 % Glycerol pH 7.4 at 25 °C

Agent conservateur: Dithiothreitol (DTT)

Précaution d'utilisation: This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.

Stock: -20 °C

Stockage commentaire: GenCrispr Cas9 is supplied with 1X storage buffer (10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and is recommended to be stored at -20°C.br/>Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).

Détail du antigène

Antigène: CRISPR-Cas9

Autre désignation: Cas9 Nuclease

Sujet: GenCrispr Cas9 Nuclease is the recombinant Streptococcus pyogenes Cas9 (wt) protein purified from E. coli that can be used for genome editing by inducing site-specific double stranded breaks in double stranded DNA. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The RNP complex recognizes the target site by matching gRNA with the genomic DNA sequence and produces DNA breaks within 3 bases from the NGG PAM (Protospacer Adjacent Motif). With GenCrispr Cas9 nuclease, customers can screen for highly efficient gRNA in vitro using DNA cleavage assays. The high purity Cas9 protein can also be used for antibody production.