Tel:
+49 (0)241 95 163 153
Fax:
+49 (0)241 95 163 155
E-Mail:
orders@anticorps-enligne.fr

CRISPR-Cas9 (Active) Protéine

Origine: Streptococcus pyogenes Hôte: Escherichia coli (E. coli) Recombinant > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection. IVCA, MI, REP, T, IVGE Active
N° du produit ABIN3071566
  • Antigène
    CRISPR-Cas9
    Type de proteíne
    Recombinant
    Activité biologique
    Active
    Origine
    Streptococcus pyogenes
    Source
    • 1
    Escherichia coli (E. coli)
    Application
    In vitro Cleavage Assay (IVCA), Microinjection (MI), RNA Electroporation (REP), Transfection (T), In vivo Gene Editing (IVGE)
    Specificité
    Activity test
    Cas9 site-specific digestion:
    We used in vitro digestion of a linearized plasmid to determine the activity of the Cas9 nuclease. It is a sensitive assay for GenCrispr Cas9 quality control. The linearized plasmid containing the target site:
    (CATCATTGGAAAACGTTCTT)
    can be digested with gRNA:
    (CAUCAUUGGAAAACGUUCUUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUUU)
    and GenCrispr Cas9. Two cleavage DNA fragments (812 bp and 1898 bp) are determined by agarose gel electrophoresis. A 20 μL reaction in 1xCas9 Nuclease Reaction Buffer containing 160 ng linearized plasmid, 40 nM gRNA and 20 nM GenCrispr Cas9 for 2 hour at 37 °C results in 90 % digestion of linearized plasmid as determined by agarose gel electrophoresis.
    Attributs du produit
    GenCrispr Cas9-C-NLS is produced by expression in an E. coli strain carrying a plasmid encoding the Cas9 gene from Streptococcus pyogenes with a C terminal nuclear localization signal (NLS).
    Purification
    purified
    Pureté
    > 95 % pure as determined by SDS-PAGE with Coomassie Blue detection.
    niveau d'endotoxine
    Endotoxin level is <0.1eu/ug test by gel-clot method: limit test
    Ingrédients
    GenCrispr Cas9-C-NLS
    10X Reaction Buffer
  • Indications d'application
    Screening the highly efficient and specific targeting gRNAs using in vitro DNA cleavage.
    In vivo gene editing combined with specific gRNA by electroporation or injection.
    Commentaires

    1. DNA-free: no external DNA added to system.
    2. High cleavage efficiency: NLS ensures the entry of Cas9 protein into nuclei.
    3. Low off target: transient expression of Cas9 nuclease.
    4. Time-saving: no need for transcription and translation.

    Restrictions
    For Research Use only
  • Concentration
    4 mg/mL
    Buffer
    10X Reaction Buffer: 200 mM HEPES, 1M NaCl, 50 mM MgCl2, 1 mM EDTA, pH 6.5 at 25 °C.
    1X Storage Buffer: 20 mM Tris, 600 mM NaCl, 0.1 mM EDTA,1 mM DTT,50 % Glycerol PH 7.4 at 25 °C)
    Agent conservateur
    Dithiothreitol (DTT)
    Précaution d'utilisation
    This product contains Dithiothreitol (DTT): a POISONOUS AND HAZARDOUS SUBSTANCE which should be handled by trained staff only.
    Stock
    -20 °C
    Stockage commentaire
    GenCrispr Cas9-C-NLS nuclease is supplied with 1X storage buffer (20 mM Tris, 600 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% Glycerol PH 7.4 at 25°C) and recommended to be stored at -20°C.
    Diluent Compatibility: Diluent Buffer: 300 mM NaCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 500 μg/ml BSA and 50% glycerol. (pH 7.4 at 25°C).
  • Antigène
    CRISPR-Cas9
    Autre désignation
    Cas9-C-NLS Nuclease
    Sujet
    Cas9 nuclease is an RNA-guided endonuclease that can catalyze cleavage of double stranded DNA. This kind of targeted nuclease is a powerful tool for genome editing with high precision. Cas9 protein forms a very stable ribonucleoprotein (RNP) complex with the guide RNA (gRNA) component of the CRISPR/Cas9 system. The Cas9 RNP complex can localize to the nucleus immediately upon entering the cell with the addition of a nuclear localization signal (NLS). There is no requirement for transcription and translation compared with mRNA or plasmid systems. Additionally, the Cas9 RNP complex is rapidly cleared from the cell minimizing the chance of off-target cleavage when compared to other systems (Kim, et al. 2014). This DNA-free system avoids the risk of inserting foreign DNA into the genome, which can be quite useful for gene editing-based disease therapy. GenScript has developed a Cas9-C-NLS nuclease which contains a nuclear localization sequence (NLS) on the C-terminus of the protein to meet all the researchers' requirements (e.g. in vitro cleavage assay, RNP complex transfection, and micro injection).
Vous êtes ici:
Support technique